Mutation details:

cDNA level identifier:

c.413-10504_534+408delins20

Genome level identifier:

g.516016_527049delins20

Archive identifier/Other designation:

deletion of exon 4

Reference, alternative allele:

C+11036, CAAGCATCTTATTTCACCTGTAA

Genetic location (hg19):

chr6:162621752 (not available on ExAC)

Gene name:

Parkin

Consequence:

structural variation

Pathogenicity scoring:

definitely pathogenic

CADD score:

not available

Positive functional evidence:

not available

Diseases reported for this mutation:

PARK-Parkin

Number of all included cases:

1 compound heterozygous (1 in total).

×