Mutation details:

cDNA level identifier:

c.171+67708_734+58232delins28

Genome level identifier:

g.352170_812702delins28

Archive identifier/Other designation:

deletion of exons 3-6

Reference, alternative allele:

G+460533, GTCTCCACCTGCTGAGACAGGTGGATCAA

Genetic location (hg19):

chr6:162336101 (not available on ExAC)

Gene name:

Parkin

Consequence:

structural variation

Pathogenicity scoring:

definitely pathogenic

CADD score:

not available

Positive functional evidence:

not available

Diseases reported for this mutation:

PARK-Parkin

Number of all included cases:

2 homozygous (2 in total).

×