Mutation details:

Protein level identifier:

p.Pro113Thrfs*51

cDNA level identifier:

c.337_376delCCAGGAGACTCTGTGGGGCTGGCTGTCATTCTGCACACTG

Genome level identifier:

g.465172_465211delCCAGGAGACTCTGTGGGGCTGGCTGTCATTCTGCACACTG

Archive identifier/Other designation:

40bp deletion in exon 3, c.438-477del

Reference, alternative allele:

TCAGTGTGCAGAATGACAGCCAGCCCCACAGAGTCTCCTGG, T

Genetic location (hg19):

chr6:162683592

Gene name:

Parkin

Consequence:

frameshift

Pathogenicity scoring:

definitely pathogenic

CADD score:

not available

Positive functional evidence:

not available

Diseases reported for this mutation:

PARK-Parkin

Number of all included cases:

14 homozygous, 38 compound heterozygous (52 in total).

×