Mutation details:

Protein level identifier:

p.Leu552Profs*238

cDNA level identifier:

c.1632_1653dup22

Genome level identifier:

g.18198delinsTGGCCAGTGCTCGGAGCAGGGGC

Reference, alternative allele:

G, GCAGGGGCCCCACAGGCAGGCGG

Genetic location (hg19):

chr1:17320219 (not available on ExAC)

Gene name:

ATP13A2

Consequence:

frameshift

Pathogenicity scoring:

definitely pathogenic

CADD score:

34

Positive functional evidence:

16964263,; 21665991; 21724849,; 27282395,

Number of all included cases:

10 homozygous (10 in total).

×