Mutation details:

Protein level identifier (NP_071372):

p.Leu552Profs*238

cDNA level identifier (NM_022089):

c.1632_1653dup22

Gene level identifier:

g.18198delinsTGGCCAGTGCTCGGAGCAGGGGC

Reference, alternative allele:

G, GCAGGGGCCCCACAGGCAGGCGG

Genomic location hg(19)

1:17320219 (not available on ExAC)

Gene name:

ATP13A2

Consequence:

frameshift

Pathogenicity scoring:

Definitely pathogenic

CADD score:

34

Positive functional evidence:

21665991;

Number of all included cases:

5 homozygous (5 in total).

×